Haya, Nur (2018) Perbandingan Efektivitas Gen CHD dan Intronik W dan Z Kromosom dalam Penentuan Jenis Kelamin Burung Jenjang Mahkota (Balearica regulorum) dengan Teknik Polimerase Chain Reaction. Sarjana thesis, Universitas Brawijaya.
Abstract
Berdasarkan morfologinya unggas terbagi menjadi dua golongan yaitu dimorfik dan monomorfik. Dimorfik merupakan unggas yang jenis kelaminnya dapat ditentukan secara morfologi, sedangkan monomorfik unggas yang jenis kelaminnya sulit dibedakan secara morfologi. Pada jenis monomorfik perlu dilakukan teknik molecular sexing dengan metode PCR (Polimerase Chain Reaction) untuk mengidentifikasi jenis kelamin. Pada burung jenjang mahkota (Balearica regulorum), identifikasi jenis kelamin dilakukan menggunakan gen CHD (Chromo-Helicase DNA-binding Protein) dan intronik W dan Z kromosom menggunakan teknik PCR. Pada Metode PCR dilakukan isolasi DNA pada darah menggunakan Geneaid Kit. Primer yang digunakan pada penelitian ini yaitu primer CHD-Z forward CTCCCGAGGATGAGAAACTG, reverse CTGCTCCTACTGCGTCTTCC dan primer CHD-W forward TGTTGTGTGGTTTTCGTGTG, reverse TTTTCACGGGGAATAGTTCG, dan untuk intronik W Kromosom dengan forward CACCCTGGATTGGACAACCTATTTC; dan untuk reverse TCAGAGCACTCTTTCCAGGAA, untuk intronik Z kromosom forward TAGGCTGCAGAATACAGCAT; reverse TTGTGCAGTTCTAGTCCATA. Produk PCR diuji secara kualitatif menggunakan elektroforesis agarosa 2%. Analisa data secara deskriptif kualitatif, dimana dari hasil PCR pada jantan akan terlihat satu band yaitu kromosom ZZ dan pada betina akan terlihat dua band yaitu ZW. Hasil penelitian menunjukkan bahwa gen CHD kurang efektif digunakan untuk menentukan jenis kelamin pada spesies burung jenjang mahkota (Balearica regulorum) terlihat hasil smear dan penggunaan Gen Intronik W dan Z didapatkan hasil yang efektif, yaitu pada sampel 1 dan 3 terlihat 2 band pada ukuran 151bp untuk Z dan 317bp untuk W yang teridentifikasi berjenis kelamin betina dan pada sampel 2 dan 4 terlihat 1 band pada ukuran 151bp yang teridentifikasi sebagai jantan. Gen intronik W dan Z sangat efektif digunakan untuk mengidentifikasi jenis kelamin burung jenjang mahkota.
English Abstract
Based on the morphology of aves is divided into two groups, namely dimorphic and monomorphic, where dimorphic is a type of aves that is male and female can be distinguished morphologically, while monomorphic poultry types of males and females are difficult to distinguish morphologically. So to determine gender, molecular sexing techniques are needed, namely the PCR (Polymerase Chain Reaction) method. PCR in crowned crane (Balearicaregulorum) can use genes based on CHD (Chromo-Helicase DNA-binding Protein) gene and chromosome Z and W intronics for conservation purposes. In the PCR method DNA isolation was carried out in the form of blood, DNA was taken from at Taman Safari Indonesia II and isolation used Geneaid Kit. This research was used forward primer of gen CHD primer CHD-Z forward CTCCCGAGGATGAGAAACTG, reverse CTGCTCCTACTGCGTCTTCC dan primer CHD-W forward TGTTGTGTGGTTTTCGTGTG, reverse TTTTCACGGGGAATAGTTCG, and intronik W Kromosom forward 5'CACCCTGGATTGGACAACCTATTTC3'; and reverse primer 5'TCAGAGCACTCTTTCCAGGAA3', and for intronik Z kromosom 5'TAGGCTGCAGAATACAGCAT3'; 5' TTGTGCAGTTCTAGTCCATA3'. PCR product was examined qualitatively using 2% agarose electrophoresis. Data was analyzed by descriptive qualitative. Where from the PCR results in males one band will be seen the ZZ chromosome and two females ZW. The results showed that the CHD gene ineffective was used to determine gender in crown-level bird species (Balearica regulorum) with visible results, namely smears and for the use of Intronic Genes W and Z the results were good, namely two male birds identified. and two female birds, where one band was seen in the size of 151bp for male birds and two bands were seen in sizes 151bp for Z and 317bp for W in female birds. The intronic W and Z genes are very effective to be used to identify the sex of the crown-level bird.
Item Type: | Thesis (Sarjana) |
---|---|
Identification Number: | SKR/FKH/2018/201/051900930 |
Uncontrolled Keywords: | Unggas, molecular sexing,CHD, intronik W kromosom, intronik Z kromosom / Aves, molecular sexing, CHD, intronic chromosome W, intronic chromosome Z |
Subjects: | 600 Technology (Applied sciences) > 636 Animal husbandry > 636.5 Chickens and other kinds of domestic birds > 636.508 2 Chickens and other kinds of domestic birds (Breeding) > 636.508 21 Chickens and other kinds of domestic birds (Genetics) |
Divisions: | Fakultas Kedokteran Hewan > Kedokteran Hewan |
Depositing User: | Endang Susworini |
Date Deposited: | 28 May 2020 08:28 |
Last Modified: | 26 Aug 2020 03:28 |
URI: | http://repository.ub.ac.id/id/eprint/167864 |
Actions (login required)
![]() |
View Item |