Setia, Imanda Nurul (2018) Eksplorasi Bakteri Diazotrof Rhizosfer Jeruk Keprok (Citrus Reticulata L.) Varietas Batu 55 Sebagai Agen Plant Growth Promoting Rhizobacteria (PGPR). Magister thesis, Universitas Brawijaya.
Abstract
Jeruk merupakan salah satu komoditas buah-buahan yang memiliki nilai ekonomi tinggi. Jeruk keprok (Citrus reticulata L.) varietas Batu 55 dikembangkan di Jawa Timur sejak tahun 2005. Kultur mikroba yang memiliki berbagai aktivitas peningkatan pertumbuhan atau Plant Growth Promoting Rhizobacteria (PGPR) mulai dikembangkan untuk mengurangi kebergantungan pada pupuk dan pestisida kimia serta menjaga produktivitas tanaman jeruk. Mekanisme mikroba PGPR dalam meningkatkan pertumbuhan tanaman dapat melalui aktivitas penyediaan nutrisi dan stimulasi produksi fitohormon oleh agen biofertilizer atau melalui aktivitas biokontrol oleh agen biopestisida yang mampu menghambat pertumbuhan mikroba patogen dengan memproduksi antibiotik dan metabolit yang bersifat antimikroba. Tujuan penelitian ini untuk mempelajari potensi bakteri diazotrof rhizosfer tanaman jeruk keprok Batu 55 sebagai agen PGPR dan mengidentifikasi strain-strain bakteri diazotrof rhizosfer yang memiliki beragam aktivitas biologis (single species with multi activities) khususnya kemampuan dalam fiksasi nitrogen, pelarutan fosfat, produksi hormon Indole Acetic Acid (IAA), dan biokontrol patogen tanaman jeruk. Tahapan penelitian meliputi isolasi bakteri pemfiksasi nitrogen (diazotrof) dari tanah rhizosfer tanaman jeruk dengan metode serial dilusi, kemudian diuji aktivitasnya sebagai agen biofertilizer melalui uji pemfiksasi nitrogen, uji produksi IAA, dan uji pelarutan fosfat. Konsentrasi nitrogen terfiksasi diukur menggunakan Sera Ammonia Test Kit dan Reagen Nessler, hormon IAA diukur menggunakan Reagen Salkowsky, dan aktivitas pelarutan fosfat dianalisis menggunakan uji kolorimetri dengan Reagen Kloromolibdat dan asam Klorostan. Aktivitas bakteri diazotrof sebagai agen biopestisida diuji menggunakan metode dual kultur untuk mengevaluasi daya hambat bakteri diazotrof terhadap mikroba patogen tanaman jeruk. Mikroba patogen diisolasi dari sampel organ tanaman jeruk yang terinfeksi. Uji kemampuan bakteri diazotrof dalam fiksasi nitrogen, pelarutan fosfat, produksi hormon Indole Acetic Acid (IAA), dan biokontrol patogen dilakukan menggunakan Rancangan Acak Lengkap (RAL) dengan tiga kali ulangan. Data dianalisis ragam (ANOVA) menggunakan program Windows SPSS software v. 20. Kandidat isolat PGPR unggul diidentifikasi berdasarkan sekuen 16S rDNA. Sekuen 16S rDNA diamplifikasi menggunakan PCR dengan primer 27f (5’ –AGAGTTTGATCCTGG CTCAG– 3’) dan 1492r (5’ –CTACGGCTACCTTGTTACGA– 3’), sedangkan isolat kapang patogen terpilih diamplifikasi menggunakan primer ITS dengan primer forward ITS5 (5’- GGAAGTAAAAGTCGTAACAAGG-3’) dan primer reverse ITS4 (5′- TCCTCCGCTTATTGATATGC-3′). Berdasarkan hasil penelitian didapatkan bahwa isolat Dbs 1, Dbs 2, dan Dbm 3 memiliki kemampuan dalam memfiksasi nitrogen, melarutkan fosfat, dan menghasilkan hormon IAA, tetapi hanya isolat Dbs 2 dan Dbm 3 yang memiliki kemampuan biokontrol terhadap patogen jeruk keprok. Isolat Dbs 1, Dbs 2, dan Dbm 3 secara berurutan mampu memroduksi ammonia 10 μg/mL; 9,1 μg/mL; dan 3,8 μg/mL, menghasilkan IAA sebesar 30,08 μg/mL; 24,68 μg/mL; dan 190,77 μg/mL, melarutkan fosfat sebesar 11,3 μg/mL; 8,6 ix μg/mL; dan 2,2 μg/mL. Isolat Dbs 2 mampu menghambat kapang patogen PD 3, PBa 4, dan PBa 2 secara berurutan dengan persentase penghambatan 76,6 %; 75,4 %; dan 100 %, serta penghambatan oleh isolat Dbm 3 sebesar 54,8 %; 46,9 %; dan 55,7 %. Isolat Dbs 1, Dbs 2, dan Dbm 3 berdasarkan sekuen 16S rDNA secara berurutan berkerabat dengan Acinetobacter schindleri ZSR6 dengan nilai similaritas 99,93 %, Pseudomonas syncyanea NBRC3757T dengan nilai similaritas 100 %, dan Pseudomonas moraviensis F9-6 dengan nilai similaritas 99,93 %. Kapang patogen PBa 2 dan PBa 4 berdasarkan sekuen ITS secara berurutan berkerabat dengan Fusarium equiseti FEIF14 dan Colletotrichum gloeosporioides CS69. Masing-masing isolat tersebut memiliki nilai similaritas sebesar 100 %, sedangkan isolat PD 3 masih belum teridentifikasi
English Abstract
Citrus is one of fruits commodity which has high economic value. Tangerine (Citrus reticulata L.) var. Batu 55 have been developed in East Java since 2005. Currently, microbial cultures which have a wide range of activity to increase plant growth or Plant Growth-Promoting Rhizobacteria (PGPR) was developed. This product can be used to reduce dependence on chemicals pesticide and fertilizer, and also maintains the citrus productivity. The mechanism of microbial PGPR to enhance plant growth by nutrition supply activities and stimulation of phytohormone production or biocontrol activity to inhibit the growth of pathogenic microbes by producing antimicrobial metabolites. This research is aimed to study the potency of Tangerine var. Batu 55 diazotroph rhizobacteria as PGPR agent and to identify strains of diazotroph rhizobacteria which have multi-biological activities (single species with multi-activities) especially the activity of nitrogen fixation, phosphate solubilizing, IAA production, and activity to inhibit the growth of the pathogen. Methods of the research consist of isolation of nitrogen-fixing bacteria (diazotroph) from organic Tangerine rhizosphere soil using serial dilution methods, screening of biofertilizer activity was determine by nitrogen fixation test, phytohormone Indole Acetic Acid (IAA) production test, phosphate-solubilizing test. Nitrogen fixation was quantified using Sera Ammonia Test Kit and Nessler reagent, IAA production was quantified using Salkowsky reagent, and phosphate solubilized was measured using chloromolibdate and chlorostannous acid. Screening of biopesticide activity was determine by dual culture method for determine growth inhibition of pathogen by diazotroph bacteria. Nitrogen fixation test, phytohormone Indole Acetic Acid (IAA) production test, phosphate-solubilizing test, and activity to inhibit the growth of the pathogen were carried out according Complete Randomized Design (CRD) with three replications. Data were analyzed of variance (ANOVA) using SPSS software version 20. Candidate of PGPR isolates were identified based on 16S rDNA sequences. Amplification of 16S rDNA sequences using PCR with primers 27f (5 '-GAG AGT TTG CTG GCT ATC CAG- 3') and 1495r (5 '-CTA CGG CTA TGT CCT GA- TAC 3'), while selected mould isolates were amplified using primer ITS with ITS5 primer forward (5'- GGAAGTAAAAGTCGTAACAAGG -3') and reverse primer ITS4 (5'- TCCTCCGCTTATTGATATGC-3'). Isolates of Dbs 1, Dbs 2, and Dbm 3 capable producing ammonia up to 10 μg/mL; 9.1 μg/mL; and 3.8 μg/mL, IAA production were 30.08 μg/mL; 24.68 μg/mL; and 190.77 μg/mL, phosphate solubilizing were 11.3 μg/mL; 8.6 μg/mL; and 2.2 μg/mL, respectively. Isolate Dbs 2 was able to inhibit the growth of PD 3, PBa 4, and PBa 2 pathogen with the percentage of inhibition were 76,6 %; 75.4 %; and 100 %, while the percentage of inhibition by isolate Dbm 3 was 54,8 %; 46.9 %; and 55.7 % respectively. According to the 16S rDNA sequence similarity, Dbs 1, Dbs 2, and Dbm 3 isolates were proven similar to Acinetobacter schindleri ZSR6, Pseudomonas syncyanea NBRC3757T, and Pseudomonas moraviensis F9-6 with similarity value of 99,93 %; 100 %; 99,93 %, respectively. Pathogen mould PBa 2 and PBa 4 based on sequences were proven similar to Fusarium xi equiseti FEIF14 and Colletotrichum gloeosporioides CS69, respectively. Each isolate had similarity value of 100 %, while isolate PD 3 was not identified yet
Other obstract
-
| Item Type: | Thesis (Magister) |
|---|---|
| Identification Number: | TES/631.847/SET/e/2018/041802355 |
| Uncontrolled Keywords: | Bakteri Diazotrof Rhizosfer Jeruk Keprok , Agen Plant Growth Promoting Rhizobacteria |
| Subjects: | 600 Technology (Applied sciences) > 631 Specific techniques; apparatus, equipment materials > 631.8 Fertilizers, soil conditioners, growth regulators > 631.84 Nitrogen fertilizers |
| Divisions: | S2/S3 > Magister Biologi, Fakultas MIPA |
| Depositing User: | Endang Susworini |
| Date Deposited: | 09 Aug 2022 07:37 |
| Last Modified: | 09 Aug 2022 07:37 |
| URI: | http://repository.ub.ac.id/id/eprint/193083 |
![[thumbnail of Imanda Nurul Setia.pdf]](http://repository.ub.ac.id/style/images/fileicons/text.png) |
Text
Imanda Nurul Setia.pdf Download (1MB) |
Actions (login required)
 |
View Item |