Inayah, Afifi (2015) Polimorfisme Gen Gdf-9 (Growth Differentiation Factor 9) Exon 2 Dan Struktur Tiga Dimensi Protein Gdf-9 Pada Sapi Friesian Holstein (FH). Magister thesis, Universitas Brawijaya.
Abstract
Sapi Friesian Holstein (FH) merupakan jenis sapi perah yang dapat diandalkan sebagai sumber protein hewani dan pemenuhan kebutuhan tersebut tergantung pada populasi sapi FH. Laju populasi sapi FH ditentukan oleh performans reproduksi induk betina, dimana laju ovulasi merupakan faktor penting dalam performans tersebut. Laju ovulasi yang diawali oleh peristiwa folikulogenesis. Salah satu gen yang berperan untuk mengontrol laju ovulasi dan folikulogenesis adalah gen GDF-9 (Growth Differentiation Factor-9). Mutasi yang terjadi pada GDF-9 diketahui dapat meningkatkan laju ovulasi atau bahkan mengakibatkan sterilitas hewan ternak. Mutasi missense yang terjadi pada Norwegian White Sheep menunjukkan adanya perubahan asam amino (V371M) pada exon 2 yang berdampak pada fertilitas mamalia tersebut. Penelitian ini bertujuan untuk mengetahui adanya polimorfisme gen GDF-9 pada sapi FH dan pengaruhnya terhadap struktur tiga dimensi GDF-9 yang berpotensi mengakibatkan terjadinya perubahan interaksi dari protein tersebut. Sepuluh sapi FH betina diambil darahnya untuk diisolasi DNA whole genome dan diukur kemurnian serta konsentrasi DNA. Amplifikasi DNA dilakukan menggunakan pasangan primer yang spesifik terhadap gen GDF-9 pada posisi exon 2. Pasangan primer tersebut yakni 5`AAGACTCTCCCTAGAGCTCCATACTC 3` dan 5`TAGAACTGCAATTCCACCCAAG 3`. Polimorfisme gen GDF-9 diamati melalui analisis skuensing menggunakan satu primer (primer forward). Proses sekuensing dilakukan di 1stBase Pte. Ltd., Malaysia. Hasil sekuensing kemudian disejajarkan dengan gen GDF-9 dari berbagai spesies melalui web server BLAST untuk memperoleh template alignment melalui nilai maximum identity. Sampel disejajarkan kembali dengan template menggunakan software MEGA5. Sekuens nukleutida sampel dan template kemudian diterjemahkan menjadi sekuens asam amino menggunakan MEGA5. Prediksi dampak mutasi dianalisis menggunakan web server projectHOPE, sementara struktur tiga dimensi ix dibuat menggunakan web server SWISS MODEL dan divalidasi dengan Ramachandran Plot. Struktur yang diperoleh disuperimpose dan didocking dengan protein BMP-15. Hasil amplifikasi DNA diperoleh satu pita DNA dengan ukuran ± 1100 bp. Penyejajaran dengan BLAST menunjukkan bahwa template yang dapat digunakan untuk analisis polimorfisme adalah gen GDF-9 Bos taurus karena memiliki maximum identity 99- 100%. Penyejajaran sekuens nukleutida GDF-9 sampel dengan template menunjukkan adanya SNP (Single Nucleutide Polymorphism) G1358A pada sampel ke-9 yang memiliki riwayat performans reproduksi tidak berahi. Hasil penerjemahan sekuens menunjukkan bahwa G1358A merubah asam amino arginin (R) menjadi histidin (H) pada posisi 453 (R453H). ProjectHOPE memprediksikan bahwa mutasi tersebut dapat merubah ukuran rantai samping protein GDF-9 pada posisi 453. Arginin dan histidin merupakan kelompok reisud hidrofilik dan memiliki muatan positif. Superimpose protein GDF-9R453H dan wild type menunjukkan bahwa protein GDF-9R435H memiliki ukuran residu yang lebih pendek dibandingkan wild type. Docking protein wild type dengan BMP-15 menghasilkan energi binding sebesar -85,58 sementara GDF-9R453H dengan BMP 15 memiliki energi binding sebesar -80,79. Perbedaan tersebut dikarenakan terjadinya perbedaan interaksi masingmasing residu pada kedua kompleks protein tersebut. Hal ini menunjukkan bahwa mutasi GDF-9 pada exon 2 mengakibatkan perubahan struktur dan interaksi protein dikarenakan adanya perubahan ukuran, rantai samping, nilai hidrofobisitas dan energi binding dari protein.
English Abstract
Friesian Holstein (FH) is one of dairy cattle that can be relied upon as a source of animal protein and to provide it depends on population rate of FH cattle. population of FH cattle is determinded by female reproduction performance where ovulation rate is important factorin that performance, Ovulation rate is initiated by folliculogenesis process. One of genes that controlled rate of ovulation and folliculogenesis is GDF- 9 gene (Growth Differentiation Factor-9 ). Mutations in GDF-9 may increase rate of ovulation or even lead to sterility livestock. Missense mutations on a sample of Norwegian White Sheep showed amino acid changes (V371M) on position of exon 2 that affect mammalian fertility. This study aims to determine presence of GDF-9 gene polymorphism in cattle FH and its influence on three-dimensional structure of GDF-9 and its influence on three-dimensional structure of GDF-9 which could potentially lead to a change in interaction of se proteins. Blood samples were taken from ten FH cattle for DNA isolated and determined its concentration and purity. DNA amplification using primers specific for GDF-9 gene in exon 2 position. primer pairs was 5`AAGACTCTCCCTAGAGCTCCATACTC 3` dan 5`TAGAACTGCAATTCCACCCAAG 3`. DNA amplification using primers specific for GDF-9 gene on position of exon 2. Sequencing analysis performed using forward primer only and sequencing processed at 1stBase Pte. Ltd., Malaysia. sequencing results aligned with GDF-9 from various species through BLAST web server to obtain template alignment through identity maximum value and re-aligned with template by using MEGA software. se sequences were translated into amino acid sequences using MEGA5. prediction of mutation impact was analyzed by using projectHOPE web server, while three-dimensional structure made by using SWISS MODEL homology based modelling and validated with Ramachandran plot. n, se results superimposed and docked with protein dimer of GDF-9 which is BMP-15. xi results of DNA amplification showing re was one band DNA of ± 1100 bp. Alignment with BLAST show templates that can be used for analysis of gene polymorphism is GDF-9 of Bos taurus due to it has 99-100% maximum identity score. GDF-9 sequences sample alignment with template showed presence of SNP (Single Nucleutide Polymorphism) G1358A at ninth (9th) sampel which had no history of estrus. results showed that SNP sequences change translation of amino acid from arginine (R) become histidine (H) at position 453 (R453H). ProjectHOPE predicted that se mutations can alter size of side chains of GDF-9 proteins at position 453. Arginine and histidine are reisud hydrophilic groups and has a positive charge. Superimpose GDF-9R453H and wild type protein also showed GDF-9R453H has amino acid residue shorter than wild type. Docking wildtype protein with BMP-15 is about -85,58 binding energies while GDF- 9R453H has -80,79 binding energies. difference of energy binding is due to difference in interaction of each residue in those protein complex. This suggested that GDF-9 gene mutations in exon 2 changes structure and protein interaction due to changes in size, side chain, hydrophobicity value and binding energy of GDF-9 protein.
| Item Type: | Thesis (Magister) |
|---|---|
| Identification Number: | TES/636.234/INA/p/041502098 |
| Subjects: | 600 Technology (Applied sciences) > 636 Animal husbandry > 636.2 Cattle and related animals |
| Depositing User: | Samsul Arifin |
| Date Deposited: | 20 Apr 2015 10:35 |
| Last Modified: | 20 Apr 2015 10:35 |
| URI: | http://repository.ub.ac.id/id/eprint/159007 |
Actions (login required)
 |
View Item |