Yanti, Qur`aini (2016) Identifikasi Jenis Kelamin Ayam Mutiara (Numida Meleagris) Berdasarkan Gen Chd (Chromo-Helicase Dna-Binding) Menggunakan Metode Polymerase Chain Reaction (Pcr). Sarjana thesis, Universitas Brawijaya.
Abstract
Unggas dibedakan menjadi dua berdasarkan morfologinya yaitu dimorfik dan monomorfik. Dimorfik memiliki perbedaan morfologi pada jantan dan betina. Sedangkan monomorfik tidak meiliki perbedaan morfologi, sehingga sulit untuk dibedakan jenis kelaminnya berdasarkan morfologinya saja, salah satunya yaitu ayam mutiara (Numida meleagris). Penentuan jenis kelamin pada unggas diperlukan untuk kepentingan konservasi. Teknik molekuler (molecular sexing) Polymerase Chain Reaction (PCR) digunakan untuk membedakan jenis kelamin berdasarkan gen CHD (Chromo-Helicase DNA-binding Protein). DNA diperoleh dari 10 ekor bulu ayam mutiara di Taman Safari Indonesia II dan diisolasi menggunakan DNeasy® Blood and Tissue Kit (Qiagen). Primer yang digunakan pada penelitian ini yaitu primer CHD-Z forward CTCCCGAGGATGAGAAACTG, reverse CTGCTCCTACTGCGTCTTCC dan primer CHD-W forward TGTTGTGTGGTTTTCGTGTG, reverse TTTTCACGGGGAATAGTTCG. Hasil penelitian menunjukkan bahwa primer CHD-Z dapat digunakan untuk menentukan jenis kelamin ayam mutiara. Sepuluh sampel ayam mutiara tersebut menunjukkan 5 sampel menghasilkan satu pita yang mengindikasikan jenis kelamin jantan dan 5 sampel menghasilkan dua pita yang mengindikasikan jenis kelamin betina. Primer CHD-W yang digunakan pada penelitian ini tidak berhasil mengamplifikasi gen CHD-W sehingga tidak dapat digunakan untuk mengidentifikasi jenis kelamin. Hasil purifikasi produk PCR gen CHD-Z yang menunjukkan konsentrasi tinggi dipilih untuk dilanjutkan pada sekuensing. Hasil sekuensing tersebut dibandingkan dengan gen CHD-Z Gallus gallus, dengan menunjukkan adanya beberapa perubahan urutan basa nukleotida ke 37, 40, 56, 59, 83,84, 94, 101, 102 (c.37C>A; c.40G>T; c.56C>G; c.c.59C>T; c.83g>a; c.84A>G; c.94C>T; c.101C>T; c.102C>T) dan insersi pada urutan basa nukleotida ke 63, 64 dan 92 (c.63>T; c.64>T; c.92>A).
English Abstract
Aves could be divided by the morphology, that was dimorphic and monomorphic. Dimorphic has difference morphology between males and females. While monomorphic had no difference morphology, so it was difficult to distinguish the sex only based on the morphology, one of the example is guinea fowl (Numida meleagris). Sex identification on aves was needed for conservation. Molecular sexing by Polymerase Chain Reaction (PCR) was used to distinguish the sex based on CHD gene (Chromo-Helicase DNA-binding protein). DNA was obtained from feathers on 10 guniea fowl in Taman Safari Indonesia II and isolated using DNeasy® Blood and Tissue Kit (Qiagen). This research was used forward primer of CHD-Z 5’-CTCCCGAGGATGAGAAACTG-3’, and reverse primer of CHD-Z 5’-CTGCTCCTACTGCGTCTTCC-3’, as well forward primer of CHD-W 5’-TGTTGTGTGGTTTTCGTGTG-3’, and reverse primer of CHD-W 5’-TTTTCACGGGGAATAGTTCG-3’. The results showed that 10 samples guinea fowl could be differentiated by electrophoresis band resulted one band on five samples that indicates male and two bands on 5 samples that indicated females. Primer CHD-W was used in this study, did not success to amplify the CHD-W gene and therefore could not use to identify the sex. The purified PCR product of CHD-Z gene sample No. 4 (male) which showed high concentrations then continued for sequencing. The sequensing results compared with CHD-Z Gallus gallus which showed a few difference of nucleotide sequences number 37, 40, 56, 59, 83.84, 94, 101, 102 (c.37C> A; c.40G> T c .56C> G; cc59C> T; c.83g> a; c.84A> G; c.94C> T; c.101C> T; c.102C> T) and the insertion at nucleotide base number 63, 64 and 92 (c.63Ins T; c.64InsT; c.92InsA).
Item Type: | Thesis (Sarjana) |
---|---|
Identification Number: | SKR/FKH/2016/9/ 051602831 |
Subjects: | 600 Technology (Applied sciences) > 636 Animal husbandry > 636.08 Specific topics in animal husbandry > 636.089 Veterinary medicine |
Divisions: | Fakultas Kedokteran Hewan > Kedokteran Hewan |
Depositing User: | Kustati |
Date Deposited: | 18 May 2016 09:13 |
Last Modified: | 18 May 2016 09:13 |
URI: | http://repository.ub.ac.id/id/eprint/127237 |
Actions (login required)
View Item |