Studi Filogenetik Genus Ptyas (Fitzinger, 1843) Di Pulau Jawa Dan Sumatera Berdasarkan Gen Natrium Dehidrogenase Subunit 4 (Nd4)

Abdillah, Muhammad Farih (2017) Studi Filogenetik Genus Ptyas (Fitzinger, 1843) Di Pulau Jawa Dan Sumatera Berdasarkan Gen Natrium Dehidrogenase Subunit 4 (Nd4). Sarjana thesis, Universitas Brawijaya.

Abstract

Penelitian ini bertujuan untuk mengetahui hubungan kekerabatan Genus Ptyas di Pulau Jawa dan Sumatera berdasarkan gen Natrium Dehidrogenasi Subunit 4 (ND4). Metode penelitian yang dilakukan yaitu isolasi DNA sesuai standar protocol QIAmp®DNA Mini Kit, amplifikasi, sekuensing dan analisis data. Isolasi DNA menggunakan jaringan otot dari Ptyas korros, Ptyas mucosa, Ptyas carinata dan Ptyas fuscus serta sampel Ptyas korros dan Ptyas mucosa (Myanmar), Ptyas carinata (Singapura) yang diambil dari data di GenBank, selanjutnya diuji kualitatif dengan elektroforesis dan diamplifikasi dengan primer ND4 (Forward) 5’TGACTACCAAAAGCTCATGTAGAAGC3’ dan LEU (Reverse) 5’TACTTTTACTTGGATTTGCACCA3’. Analisis filogenetik menggunakan Maximum Parsimony (MP), Maximum Likelihood (ML) dan Bayesian Inference. Hasil penelitian menunjukkan terbentuk 3 clade (A, B, C) dari Genus Ptyas di Paparan Sunda, Myanmar dan Singapura. Clade A terdiri dari spesies P. korros yang berasal dari Jawa, Sumatera dan Myanmar. Clade B terdiri dari spesies P. carinata (Jawa, Sumatera dan Singapura), P. mucosa (Jawa, Myanmar) dan P. fuscus (Aceh), serta clade C yang merupakan outgroup (Elaphe bimaculata). Nilai uncorrected p-Distance antara spesies P. korros dengan P. carinata antara 18-21%, P. korros dan P. mucosa 15-18%, P. korros dan P. fuscus 18-21%, P. carinata dan P. mucosa 12-13%, P. carinata dan P. fuscus 14%, P. mucosa dengan P. fuscus 15-16%.

English Abstract

The goals of this study was to know the kinship relationship of the Ptyas Genus on Java and Sumatera based on the Sodium Dehydrogenation Subunit 4 (ND4) gene. This research using DNA isolation method according to QIAmp®DNA Mini Kit standard protocol, amplification, sequencing and data analysis. DNA isolation using tissue from Ptyas korros, Ptyas mucosa, Ptyas carinata and Ptyas fuscus and samples of Ptyas korros and Ptyas mucosa (Myanmar), Ptya carinata (Singapore) taken data from GenBank, were then qualitatively tested with electroforesis and amplified with primary ND4 (Forward) 5'TGACTACCAAAAGCTCATGTAGAAGC3 'and LEU (Reverse) 5'TACTTTTACTTGGATTTGCACCA3'. Phylogenetic analysis using Maximum Parsimony (MP), Maximum Likelihood (ML) and Bayesian Inference. The results showed 3 clones (A, B, C) of the genus Ptyas in Exposure Sunda, Myanmar and Singapore. Clade A consists of P. korros species originating from Java, Sumatera and Myanmar. Clade B consists of P. carinata species (Java, Sumatera and Singapore), P. mucosa (Java, Myanmar) and P. fuscus (Aceh), and clade C which is outgroup (Elaphe bimaculata). Value of uncorrected p-Distance between species P. korros and P. carinata between 18-21%, P. korros and P. mucosa 15-18%, P. korros and P. fuscus 18-21%, P. carinata and P. Mucosa 12-13%, P. carinata and P. fuscus 14%, P. mucosa with P. fuscus 15-16%.

Item Type: Thesis (Sarjana)
Identification Number: SKR/FMIPA/2017/318/051709658
Uncontrolled Keywords: genus Ptyas, filogenetik, natrium dehidrogenase subunit 4 (ND4), jawa, sumatera
Subjects: 500 Natural sciences and mathematics > 597 Cold-blooded vertebrates > 597.9 Reptilia (Reptiles) > 597.96 Serpentes (snakes) > 597.962 Colubridae
Divisions: Fakultas Matematika dan Ilmu Pengetahuan Alam > Biologi
Depositing User: Nur Cholis
Date Deposited: 20 Oct 2017 02:28
Last Modified: 23 Nov 2021 07:26
URI: http://repository.ub.ac.id/id/eprint/4074
[thumbnail of BAB IV.pdf]
Preview
Text
BAB IV.pdf

Download (3MB) | Preview
[thumbnail of LAMPIRAN.pdf]
Preview
Text
LAMPIRAN.pdf

Download (779kB) | Preview
[thumbnail of BAB V.pdf]
Preview
Text
BAB V.pdf

Download (325kB) | Preview
[thumbnail of DAFTAR PUSTAKA.pdf]
Preview
Text
DAFTAR PUSTAKA.pdf

Download (1MB) | Preview
[thumbnail of BAB I.pdf]
Preview
Text
BAB I.pdf

Download (798kB) | Preview
[thumbnail of BAGIAN DEPAN.pdf]
Preview
Text
BAGIAN DEPAN.pdf

Download (689kB) | Preview
[thumbnail of BAB III.pdf]
Preview
Text
BAB III.pdf

Download (2MB) | Preview
[thumbnail of BAB II.pdf]
Preview
Text
BAB II.pdf

Download (6MB) | Preview

Actions (login required)

View Item View Item