Analisis Keragaman Gen Secreted Phospoprotein 1 (SPP1) terhadap Kualitas Semen Segar Pada Sapi Limousin (Bos Taurus) Jantan dengan Metode Polymerase Chain Reaction-Restriction Fragment Length Polymophism

Setiyoningrum, Astika Dwi Sawitri (2020) Analisis Keragaman Gen Secreted Phospoprotein 1 (SPP1) terhadap Kualitas Semen Segar Pada Sapi Limousin (Bos Taurus) Jantan dengan Metode Polymerase Chain Reaction-Restriction Fragment Length Polymophism. Sarjana thesis, Universitas Brawijaya.

Abstract

Gen secreted phospoprotein 1 (SPP1) pada sapi terletak pada kromosom 6 yang terdiri atas tujuh exon dan enam intron dengan ukuran sekitar 7.000 basa dari total genom. Fungsi dari protein SPP 1 sebagai salah satu faktor dekapasitasi untuk mencegah aktivasi dini motilitas sperma. Salah satu teknik yang dapat diaplikasikan dalam mendeteksi adanya polimorfisme yaitu Polymerase Chain Reaction-Restriction Fragment Length Polymophism (PCR-RFLP). Teknik tersebut memerlukan beberapa tahapan, antara lain isolasi DNA, amplifikasi gen SPP1 menggunakan metode PCR dengan primer SPP1 F 5’ - GCAAATCAGAAGTGATAGA - 3’ dan SPP 1 R 5’ - CCAAGCCAAACGTATGAGTT - 3 (290bp), elektroforesis, dan RFLP menggunakan enzim restriksi HindIII. Kemudian data yang didapatkan akan di analisa menggunakan uji Spearman. Hasil korelasi antara jumlah pita RFLP dengan konsentrasi semen menunjukkan korelasi lemah dan searah (r=0,231), sementara korelasi jumlah pita RFLP dengan motilitas semen menunjukkan korelasi sangat lemah dan tidak searah (r=0,072). Berdasarkan hasil tersebut polimorfisme gen SPP1 memiliki pengaruh terhadap kualitas semen segar khususnya pada motilitas dan konsentrasi sperma.

English Abstract

The secreted phospoprotein 1 (SPP1) gene in bulls is located in chromosome 6 consisting of seven exons and six introns with size about 7,000 bases of the total genome. The SPP1 serves as a decapitation factor to prevent early activation of sperm motility. This research aimed to detect the polymorphism of SPP1 using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR RFLP) which then correlated to sperm concentration and motility level. The initial method started with DNA isolation continued by gene amplification with primer SPP1 F (5’-GCAAATCAGAAGTGATAGA-3’) and SPP 1 R (5’-CCAAGCCAAACGTATGAGTT-3). The PCR method yielded 290 bp amplicon and followed by RFLP using HindIII as a restriction enzyme. The restriction reaction produced a number of bands as indicator of polymorphism. The correlations of the number of bands towards sperm concentration and motility level were analysed using Spearman test. The correlation between the number of bands with sperm concentration showed a weak positive correlation (r=0.231). While the correlation between the number of bands with sperm motility showed a very weak negative correlation (r = 0.0728). The SPP1 gene may have an influence on the fresh semen quality, however, there was no significant correlation of SPP1 polymorphism towards sperm concentration and motility.

Other obstract

-

Item Type: Thesis (Sarjana)
Identification Number: SKR/FKH/2020/64/052003844
Uncontrolled Keywords: Inseminasi Buatan, Semen, SPP1, PCR-RFLP, dan HindIII, Artificial insemination, Semen, SPP1, PCR-RFLP, HindIII
Subjects: 600 Technology (Applied sciences) > 636 Animal husbandry > 636.2 Cattle and related animals > 636.21 Cattle for specific purposes
Divisions: Fakultas Kedokteran Hewan > Kedokteran Hewan
Depositing User: Budi Wahyono Wahyono
Date Deposited: 10 Aug 2020 06:35
Last Modified: 09 Jan 2023 01:11
URI: http://repository.ub.ac.id/id/eprint/181312
[thumbnail of DALAM MASA EMBARGO] Text (DALAM MASA EMBARGO)
Astika Dwi Sawitri Setiyoningrum (2).pdf - Published Version
Restricted to Registered users only until 31 March 2023.

Download (5MB)

Actions (login required)

View Item View Item