Analisa Perbedaan Gen Warna Rambut Sapi Jaliteng (Jawa Bali Banteng) Jantan Dan Betina Berdasarkan Sekuen Gen Melanocortin-1 Receptor (Mc1r) Dengan Metode Polymerase Chainreaction (Pcr)

Siska, Parasmita Anggrian (2019) Analisa Perbedaan Gen Warna Rambut Sapi Jaliteng (Jawa Bali Banteng) Jantan Dan Betina Berdasarkan Sekuen Gen Melanocortin-1 Receptor (Mc1r) Dengan Metode Polymerase Chainreaction (Pcr). Sarjana thesis, Universitas Brawijaya.

Abstract

Sapi Jaliteng (SJ/Jawa Bali Banteng) merupakan hasil persilangan antara Sapi Bali dan Banteng jawa.Sapi Jaliteng memiliki keunikan pada warna rambut jaliteng jantan dan betina memiliki warna rambut coklat yang mengalami perubahan jantan dewasa menjadi hitam dan betina dewasa tetap berwarna coklat.Melanocortin-1 Receptor (MC1R) merupakan gen penentu warna rambut dan kulit pada mamalia. Gen MC1R meregulasi melanosit untuk membentuk pigmen melanin yang kemudian pigmen tersebut menghasilkan eumelanin dan feomelanin. Individu yang memiliki eumelanin memiliki rambut berwarna hitam dibandingkan dengan individu yang memiliki feomelanin lebih memiliki rambut oranye hingga kemerahan. Penelitian ini bertujuan untuk menentukan perbedaan warna rambut Sapi Jaliteng (SJ) Jantan dan Sapi Jaliteng (SJ) Betina. Sampel yang digunakan adalah Sapi Jaliteng (SJ1) , Sapi Bali (SB), Banteng (B) Sapi Jaliteng (SJ2),Sapi Jaliteng (SJ3),Sapi Jaliteng (SJ4),Sapi Jaliteng (SJ5) dan Sapi Jaliteng (SJ6) mengisolasi DNA melalui sampel darah lalu dilakukan uji kuantitas dan kualitas DNA, kemudian diamplifikasi menggunakan metode PCR(Polymerase Chain Reaction) dengan primer Forward MC1R_F‘5ACAATGTCATCGACGTGCTC3’dan primer Reverse MC1R_R’5AGCTATGAAGAGGCCAACGA3’.Analisasekuen SJ dan SBdilakukan dengan metodesekuensing terhadap produk PCR serta analisis dilakukan denganmenggunakan software BioEdit dan NCBI BLAST. Hasil penelitian menunjukkan bahwa gen MC1R dengan sampel SJ3 mengalami mutasi gen dengan terjadi delesi pada sekuen ke-937 (C.937delT) yang menyebabkan delesiphenylalanin (F) yaitu p.179delF pada transmembrane region MC1R. Kesimpulan terdapat perbedaan sekuen nukleutida dan asam amino di gen MC1R antara Sapi Jaliteng (SJ3) yang memiliki eumelanin dominan dari sampel Sapi Jeliteng Betina (SJ2) dan sampel Sapi Bali (SB) berambut terang yang memiliki feomelanin dominan.

English Abstract

Jaliteng cattle is the result of the crossing between the Bali’s cattle and the Java’s bull. Jaliteng cattle has a uniqueness in their hair color. Jaliteng bull and cow has brown hair color which had change, the bull’s hair color become black when they reach their adulthood and the cow still has brown hair color. Melancortin-1 Receptor (MCIR) is the determining gene of mammals skin and hair color. Melancortin-1 Receptor (MCIR) redulated melanocytes to form melanin pigment which will produce eumelanin and feomelanin. The individual which has eumelanin has black hair color compares to the individual which has feomelanin, they have orange up-to red hair color.the aim of this research is to determine the hair color difference of Jaliteng bull and Jaliteng cow. the sample that is used in this research was Jaliteng cattle (SJ1), Bali cattle (SB), bull (B) Jaliteng cattle (SJ2), Jaliteng cattle (SJ3), Jaliteng cattle (SJ4), Jaliteng cattle (SJ5) and Jaliteng cattle (SJ6) isolated the DNA through the blood sample and did quantity and quality DNA, thus amplified it used PCR (Polymerase Chain Reaction) Method with forward primary MC1R_F '5ACAATGTCATCGACGTGCTC3' and Reverse Primer MC1R_R '5AGCTATGAAGAGGCCAACGA3'the sequence analysis of SJ and SB was done by using the sequence method towards PCR product and the analysis was done by using Bio Edit software and NCBI BLAST. The results showed that the MC1R gene with SJ3 sample had a gene mutation with deletion in the 937th sequence (C.937delT) which caused deletionsphenylalanin (F) which is p.179delF in the transmembrane region MC1R. The conclusion is there are differences in nucleutide and amino acid sequences in the MC1R gene between Jaliteng Cattle (SJ3) which have dominant eumelanin from samples of Female Jeliteng Cattle (SJ2) and samples of bright-haired Balinese Cows (SB) that have dominant feomelanin.

Other obstract

-

Item Type: Thesis (Sarjana)
Identification Number: SKR/FKH/2019/110/051909040
Uncontrolled Keywords: Eumelanin, Feomelanin, MC1R, PCR, Sapi Jaliteng, :eumelanin, pheomelanin, MC1R, PCR, Jaliteng Cattle, Javanese Bali Bull Cow
Subjects: 600 Technology (Applied sciences) > 636 Animal husbandry > 636.2 Cattle and related animals > 636.208 2 Cattle and related animals (Breeding) > 636.208 21 Cattle and related animals (Genetics)
Divisions: Fakultas Kedokteran Hewan > Kedokteran Hewan
Depositing User: Nur Cholis
Date Deposited: 25 Sep 2020 07:43
Last Modified: 21 Oct 2021 04:06
URI: http://repository.ub.ac.id/id/eprint/177016
[thumbnail of PARASMITA ANGGRIAN SISKA (2).pdf] Text
PARASMITA ANGGRIAN SISKA (2).pdf

Download (2MB)
[thumbnail of Thumbnails conversion from text to thumbnail_lightbox] Other (Thumbnails conversion from text to thumbnail_lightbox)
lightbox.jpg

Download (22kB)
[thumbnail of Thumbnails conversion from text to thumbnail_preview] Other (Thumbnails conversion from text to thumbnail_preview)
preview.jpg

Download (8kB)
[thumbnail of Thumbnails conversion from text to thumbnail_medium] Other (Thumbnails conversion from text to thumbnail_medium)
medium.jpg

Download (3kB)
[thumbnail of Thumbnails conversion from text to thumbnail_small] Other (Thumbnails conversion from text to thumbnail_small)
small.jpg

Download (1kB)

Actions (login required)

View Item View Item