Analisa Kekerabatan Antar Kasuari Gelambir Ganda (Casuarius Casuarius) Terhadap Kasuari Kerdil (Casuarius Bennetti) Di Eco Green Park Berdasarkan Sekuen Gen Cyt-B Dengan Metode Polymerase Chain Reaction

Apritahani, Salsabila Widdhie (2019) Analisa Kekerabatan Antar Kasuari Gelambir Ganda (Casuarius Casuarius) Terhadap Kasuari Kerdil (Casuarius Bennetti) Di Eco Green Park Berdasarkan Sekuen Gen Cyt-B Dengan Metode Polymerase Chain Reaction. Sarjana thesis, Universitas Brawijaya.

Abstract

Kasuari Gelambir Ganda adalah salah satu satwa endemik Indonesia yang berada di Papua. Kasuari Gelambir Ganda memiliki status vulnerable, sehingga diperlukanlah tindakan breeding dan menjaga kemurnian genetik. Penelitian tentang keragaman genetik dilakukan dengan menggunakan marker dari DNA mitokondria (mtDNA). Gen cytochrome b baik digunakan untuk determinasi kekerabatan filogenetik pada spesies dikarenakan dari variabilitas sekuennya dan sekuennya terjaga dengan baik dimasing-masing spesies. Penelitian ini memiliki tujuan untuk mengetahui tingkat kekerabatan antar individu Kasuari Gelambir Ganda (Casuarius casuarius) dan dibandingkan dengan Kasuari Kerdil (Casuarius bennetti) dari data NCBI menggunakan sekuen gen cytochrome b. DNA didapatkan dari empat sampel bulu Kasuari Gelambir Ganda, 2 Kasuari jantan dan 2 Kasuari betina yang berasal dari Eco Green Park, Batu.Sampel bulu diisolasi menggunakan QIAgen® DNA Mini Kit. Primer yang digunakan dalam metode PCR adalah primer forward (CYTB_F) 5’- GCTGACACCTCACTAGCCTT-3’ dan primer reverse (CYTB_R) 5’- CGTGTGAGTGTTGGGTTGTC -3’. Hasil sekuensing dianalisa menggunakan program Bioedit dan NCBI BLAST dengan accession number NC_002778.2 untuk Kasuari gelambir ganda dan U76051.1 untuk Kasuari kerdil. Hasil penelitian jarak genetik antara NC_002778.2 dengan keempat sampel dan antar individu sampel kasuari gelambir ganda berada pada rentang 0,003-0,038. Kesimpulan penelitian ini,jarak genetik intraspesies keempat Kasuari gelambir ganda di Eco Green Park Batu berada dibawah 2%. Berdasarkan jarak genetik interspesies dan posisi pohon filogenetik, Kasuari gelambir ganda Eco Green Park berbeda kekerabatan dengan Kasuari kerdil.

English Abstract

Southern Cassowary is one of Indonesia's endemic animals in Papua. Southern Cassowary has a vulnerable status, so breeding and genetic purity are needed. Research on genetic diversity is carried out using markers from mitochondrial DNA (mtDNA). The cytochrome b gene is well used for the determination of phylogenetic relationships in species because of the variability of its sequences and its sequences are well preserved in each species. The purpose of this study was to determine the level of kinship between individuals of Southern Cassowary (Casuarius casuarius) and compared to dwarf Cassowary (Casuarius bennetti) from NCBI data using sequences of the cytochrome b. DNA was obtained from four samples of Southern Cassowary hair, 2 male Cassowaries and 2 female Cassowaries originating from Eco Green Park, Batu. Fur samples were isolated using QIAgen® DNA Mini Kit. The primers used in the PCR method are forward primer (CYTB_F) 5 '- GCTGACACCTCACTAGCCTT-3' and reverse primer (CYTB_R) 5 '- CGTGTGAGTGTTGGGTTGTC -3'. Sequencing results were analyzed using the Bioedit program and NCBI BLAST with accession number NC_002778.2 for Southern Cassowary and U76051.1 for dwarf cassowaries. The results of the genetic distance study between NC_002778.2 with the four samples and between individuals with Southern Cassowary samples were in the range 0.003-0.038. Conclusion of this study, the genetic distance of the fourth intraspecies of Southern Cassowary in the Eco Green Park Batu is below 2%. Based on interspecies genetic distance and phylogenetic tree position, Eco Green Park Southern cassowary is different from relation with dwarf cassowary.

Other obstract

-

Item Type: Thesis (Sarjana)
Identification Number: SKR/FKH/2019/112/051909044
Uncontrolled Keywords: Kasuari Gelambir Ganda, mtDNA, cyt-b, PCR, Southern Cassowary, mtDNA, cyt-b, PCR
Subjects: 500 Natural sciences and mathematics > 598 Aves (Birds) > 598.5 Palaeognathae
Divisions: Fakultas Kedokteran Hewan > Kedokteran Hewan
Depositing User: Nur Cholis
Date Deposited: 02 Nov 2020 13:26
Last Modified: 21 Oct 2021 04:09
URI: http://repository.ub.ac.id/id/eprint/176956
[thumbnail of SALSABILA WIDDHIE APRITAHANI (2).pdf] Text
SALSABILA WIDDHIE APRITAHANI (2).pdf

Download (4MB)
[thumbnail of Thumbnails conversion from text to thumbnail_lightbox] Other (Thumbnails conversion from text to thumbnail_lightbox)
lightbox.jpg

Download (19kB)
[thumbnail of Thumbnails conversion from text to thumbnail_preview] Other (Thumbnails conversion from text to thumbnail_preview)
preview.jpg

Download (8kB)
[thumbnail of Thumbnails conversion from text to thumbnail_medium] Other (Thumbnails conversion from text to thumbnail_medium)
medium.jpg

Download (2kB)
[thumbnail of Thumbnails conversion from text to thumbnail_small] Other (Thumbnails conversion from text to thumbnail_small)
small.jpg

Download (1kB)

Actions (login required)

View Item View Item