Analisis Polimorfisme Gen Growth Differentiation Factor 9 (GDF-9) dan Hubungannya dengan Keberhasilan Inseminasi Buatan pada Sapi PO

Arta, PangestiDimy (2013) Analisis Polimorfisme Gen Growth Differentiation Factor 9 (GDF-9) dan Hubungannya dengan Keberhasilan Inseminasi Buatan pada Sapi PO. Sarjana thesis, Universitas Brawijaya.

Abstract

Penelitian ini bertujuan untuk mengetahui adanya polimorfisme gen GDF-9 dan hubungannya dengan keberhasilan inseminasi buatan pada sapi PO (Bos indicus). Sepuluh (10) sampel darah sapi PO diambil dari Pasuruan secara acak. DNA diisolasi dari darah menggunakan metode Salting out. Gen GDF-9 diamplifikasi dengan teknik PCR menggunakan primer GDF-9 forward (5’- GCCCA CCCACACACCTAAAGTTTA-3’) dan GDF-9 reverse (5’ GCACA CCAACAGCTGAAAGAGGTA-3’). Amplifikasi DNA menghasilkan fragmen pita DNA dengan ukuran ± 900 bp. Polimorfisme gen GDF-9 dianalisis menggunakan teknik PCR-RFLP dengan enzim restriksi HaeIII. Berdasarkan hasil PCR-RFLP diperoleh dua tipe haplotip. Haplotip I terpotong dengan 4 ukuran fragmen DNA 70 bp, 100 bp, 290 bp dan 590 bp. Haplotip II terpotong dengan 5 ukuran fragmen DNA 70 bp, 100 bp, 120 bp, 290 bp dan 590 bp. Hasil penelitian ini menunjukkan bahwa terdapat polimorfisme gen GDF-9 pada sapi PO. Namun, tidak terdapat hubungan antara polimorfisme gen GDF-9 tersebut dengan keberhasilan inseminasi buatan pada sapi PO.

English Abstract

The aim of this research was to determine the polymorphism of GDF-9 gene in PO cattle and association with success of artificial insemination. Ten PO cattles were taken randomly from Pasuruan. DNA was isolated from blood by salting out method. DNA was amplified using primer GDF-9 forward (5’GCCCACCCACACACCTAAAGTTTA3’) and GDF-9 reverse (5’GCACACCAACAGCTGAAAGAGGTA3’). The result of PCR was a specific single band with fragment DNA size of ± 900 bp. The PCR products was digested by restriction enzyme HaeIII. The products of PCR-RFLP was two (2) haplotypes. Haplotype 1 with 4 fragment DNA (70 bp, 100 bp, 290 bp and 590 bp) and haplotype 2 with 5 fragment DNA (70 bp, 100 bp, 120 bp, 290 bp, 590 bp). This study indicate there is polymorphism of GDF-9 gene in PO cattle. However, no correlation between GDF-9 gene polymorphism with success of artificial insemination of PO cattle.

Item Type: Thesis (Sarjana)
Identification Number: SKR/MIPA/2013/318/051308369
Subjects: 500 Natural sciences and mathematics > 570 Biology
Divisions: Fakultas Matematika dan Ilmu Pengetahuan Alam > Biologi
Depositing User: Hasbi
Date Deposited: 30 Sep 2013 14:32
Last Modified: 25 Oct 2021 02:56
URI: http://repository.ub.ac.id/id/eprint/153580
[thumbnail of Skripsi_Pangesti.0910913030.pdf] Text
Skripsi_Pangesti.0910913030.pdf

Download (2MB)
[thumbnail of Thumbnails conversion from text to thumbnail_lightbox] Other (Thumbnails conversion from text to thumbnail_lightbox)
lightbox.jpg

Download (31kB)
[thumbnail of Thumbnails conversion from text to thumbnail_preview] Other (Thumbnails conversion from text to thumbnail_preview)
preview.jpg

Download (13kB)
[thumbnail of Thumbnails conversion from text to thumbnail_medium] Other (Thumbnails conversion from text to thumbnail_medium)
medium.jpg

Download (4kB)
[thumbnail of Thumbnails conversion from text to thumbnail_small] Other (Thumbnails conversion from text to thumbnail_small)
small.jpg

Download (1kB)

Actions (login required)

View Item View Item