BKG

Puspitaningsih, Widya (2016) Identifikasi Jenis Kelamin Pada Burung Emu (Dromacius Novaehollandies) Berdasarkan Analisis Gen Kw1 (Kiwi W-Specific Dna Fragment). Sarjana thesis, Universitas Brawijaya.

Indonesian Abstract

Burung Emu (Dromaius novaehollandiae) merupakan burung yang bersifat homomorfik. Teknik molecular sexing dibutuhkan untuk membedakan jenis kelamin burung Emu yaitu metode PCR (Polimerase Chain Reaction) dengan menggunakan marker penanda kromosom W spesies burung. Penelitian ini bertujuan untuk membedakan jenis kelamin jantan dan betina pada burung Emu dengan mengisolasi DNA pada kalamus bulu burung Emu. Isolasi DNA menggunakan Qiagen DNeasy (Tissue). Sampel burung Emu yang digunakan berumur 1 tahun dengan bobot badan 60 kg. Hasil DNA diuji secara kuantitatif menggunakan spectophotometry dan secara kualitatif menggunakan elektroforesis agarosa 1,5%, lalu diamplifikasi menggunakan metode PCR. Primer yang digunakan pada penelitian ini yaitu primer forward w1-k7_F (5’ATAGCATTCA CCATTTTGTTGC3’), primer reverse w1-k7_R (5’ATACGGTCTCCCTTTTT GAGG3’) sebagai penentu jenis kelamin betina dan primer forward w1-k7_F (5’CAGGATGCTCACAACCAAGA3’), primer reverse w1-k7_R (5’TCTTTG AGCAGAGGTGCAGA3’) sebagai penentu jenis kelamin jantan. Produk PCR diuji secara kualitatif (elektroforesis agarosa 2%) dan sekuensing produk PCR menggunakan metode Sanger. Analisa data secara deskriptif kualitatif. Hasil penelitian menunjukkan bahwa teknik PCR menggunakan primer w1-k7 sex male dapat menentukan jenis kelamin jantan pada burung Emu dengan menghasilkan pita DNA tunggal 219 bp, teridentifikasi 3 sampel, sedangkan untuk betina tidak menunjukkan hasil. Hasil sekuensing sampel 02 (Joni) menunjukkan perbedaan basa nuleotida terhadap database GeneBank. Perbedaan terletak pada c.94T>A; c.139A>C; c.143T>G; c.100InsC; c.113InsC; c.127InsC; c.149InsT;c.17 1InsT. Kesimpulan dari penelitian ini adalah dengan teknik PCR menggunakan primer w1-k7 sex male dapat menentukan jenis kelamin jantan dan terdapat perbedaan sekuen DNA terhadap database GeneBank pada National Center for Biotechnology Information (http://www.ncbi.nml.nih.gov).

English Abstract

The Emu (Dromacius novaehollandiae) is one of homomorfik bird. Molecular sexing techniques necessary to distinguish sex of Emu birds, that is PCR (Polymerase Chain Reaction) method using the W chromosome marker bird species. This study aimed to distinguish male and female birds by isolating the DNA in Emu bird feathers calamus. DNA isolation used Qiagen DNeasy (Tissue). Emu birds with one year old and a weight 60 kg used as research sample. The result of isolation was examined using spectophotometry quantitatively and 1.5% agarose electrophoresis quatitatively, then amplified using PCR method. Primer used in this research were forward primer of w1-k7_F (5’ATAGCATTCAC CATTTTGTTGC3’), reverse primer of w1-k7_R (5’ATACGGTCTCCCTTT TTGAGG3’) as females determinant and forward primer of w1-k7_F (5’CAGGA TGCTCACAACCAAGA3’), reverse primer of w1-k7_R (5’TCTTTGAGCAGA GGTGCAGA3’) as males determinant. PCR product was examined qualitatively (2% agarose electrophoresis) and then sequence PCR product using Sanger method. Data was analyzed by descriptive qualitative. The result of this study showed that the PCR technique using the primers w1-k7 for sex male showed the sex male with presence of single band on 219 bp, whereas the female sex showed no result. The Results of sample 02 (Joni) sequencing had different nucleotide bases against Genebank database. The difference lies in c.94T>A; c.139A>C; c.143T>G; c.100InsC; c.113InsC; c.127InsC; c.149InsT; c.171InsT. The conclusion from this study was by PCR using primers w1-k7 could determine the male sex of Emu bird, and there was differences in DNA sequences to the GenBank database at National Center for Biotechnology Information (http://www.ncbi.nml.nih.gov).

Other Language Abstract

UNSPECIFIED

Item Type: Thesis (Sarjana)
Identification Number: SKR/FKH/2016/6/ 051602828
Subjects: 600 Technology (Applied sciences) > 636 Animal husbandry > 636.08 Specific topics in animal husbandry > 636.089 Veterinary medicine
Divisions: Fakultas Kedokteran Hewan > Kedokteran Hewan
Depositing User: Kustati
URI: http://repository.ub.ac.id/id/eprint/127204
Full text not available from this repository.

Actions (login required)

View Item View Item