BKG

Lova, ApriliaNavrati (2015) Identifikasi Warna Rambut Lutung Jawa (Trachypithecus Auratus Geoffroy 1812) Rambut Hitam Dan Rambut Oranye Berdasarkan Sekuen Gen Mitf (Micropthalmia-Associated Transcription Factor). Sarjana thesis, Universitas Brawijaya.

Indonesian Abstract

Indonesia merupakan negara dengan biodiversitas yang cukup tinggi termasuk berbagai hewan endemik Indonesia, salah satunya adalah lutung Jawa (Trachypithecus auratus Geoffroy 1812). Lutung Jawa memiliki keunikan berupa perubahan warna saat beranjak dewasa dari warna lahir yaitu oranye cerah menjadi hitam atau oranye gelap saat dewasa. Perubahan warna pada rambut lutung Jawa diduga akibat pengaruh berbagai gen pigmentasi termasuk micropthalmia-associated transcription factor (MITF), adanya mutasi pada MITF umumnya menyebabkan pigmentasi yang rendah pada individu yang diduga terjadi pada lutung Jawa rambut oranye. Penelitian dilakukan untuk mengetahui perbedaan warna rambut lutung Jawa berdasarkan analisis sekuen gen MITF yang diperoleh dari folikel rambut yang diambil dari tiga lutung Jawa rambut hitam dan tiga lutung Jawa rambut oranye masing-masing 25–30 helai. Isolasi DNA dilakukan menggunakan kit isolasi DNA DNeasy Blood and Tissue Kit Qiagen. Hasil isolasi diuji secara kualitatif dan kuantitatif. Amplifikasi secara in vitro dilakukan menggunakan PCR dengan primer forward MITF_1F (’5AACAACAACCTCGGAACTGG3’) dan primer reverse MITF_1R (’5ACAAGCATGCTCCGTCTCTT3’). Produk PCR selanjutnya di-sequencing dan dianalisis secara deskriptif. Hasil penelitian menunjukkan visualisasi PCR dengan adanya pita tunggal sesuai target amplifikasi yaitu 207 bp. Penyejajaran hasil sekuen menunjukkan adanya beberapa perbedaan pada urutan basa nukleotida antara lutung Jawa rambut hitam dan rambut oranye yang diduga sebagai salah satu penyebab perbedaan warna rambut lutung Jawa. Alignment dengan BLASTN menunjukkan persentase urutan nukleotida yang tersejajarkan pada sampel lutung Jawa rambut hitam dan oranye berturut-turut adalah 97% dan 96% dan nilai persentase homologi keduanya adalah 98%.

English Abstract

Indonesia has very high biodiversity include the endemics like Javan langur (Trachypithecus auratus Geoffroy 1812). Javan langur has unique characteristic of hair color changes during growing up from bright orange to black or dark orange when mature. Hair color changes of Javan langur suspected under the influence of various genes including MITF, MITF mutation causes pigment deficiency in individuals, it was suspected occurred in Javan langur with orange hair. This study was aimed to determine the differences of Javan langur hair color based the analysis of MITF gene sequences derived from hair follicles taken from three Javan langurs black hair and orange hair each 25–30 strands. DNA isolation was performed using DNA kit isolation DNeasy Blood and Tissue Kit Qiagen. DNA isolation tested qualitatively and quantitatively. In vitro amplification was performed using PCR with forward primer MITF_1F (’5AACAACAACCTCGGAACTGG3’) and reverse primer MITF_1R (5ACAAGCATGCTCCGTCTCTT3). PCR product subsequently sequenced and analyzed descriptively. PCR visualization showed a single band on target amplification appropriately at 207 bp. Sequence alignment resulted some differences of nucleotide sequence in both of black and orange Javan langur hair was suspected as a cause of Javan langur hair color difference. Alignment with BLASTN showed the query that align with the hits of black and orange hair Javan langur sample were 97% and 96%, respecting the homology of both sample were 98%.

Other Language Abstract

UNSPECIFIED

Item Type: Thesis (Sarjana)
Identification Number: SKR/FKH/2015/135/ 051602813
Subjects: 600 Technology (Applied sciences) > 636 Animal husbandry > 636.08 Specific topics in animal husbandry > 636.089 Veterinary medicine
Divisions: Fakultas Kedokteran Hewan > Kedokteran Hewan
Depositing User: Kustati
URI: http://repository.ub.ac.id/id/eprint/127002
Full text not available from this repository.

Actions (login required)

View Item View Item